Degradation potential of basidiomycetesTrametes ljubarskyion Reactive Violet 5 (RV 5) using urea as optimum nitrogen source

Biodegradation of Reactive Dye Reactive Violet 5 by Bacteria Isolated from Dye Contaminated Soil

The Pseudomonas aeruginosa GSM3 isolated from dye contaminated soil was able to degrade Reactive Violet 5 completely as a sole source of carbon (300 mgL) within 20 h under static condition. The organism exhibited good decolorization ability in the pH ranges from 5.0 to 9.0 and temperature from 30 to 40C respectively. The optimum degradation was observed at 37C and pH 7. The maximum concentratio...

2 ‐ SIM 3 : Fw : 5 ’ ‐ GCCTGCAGCTGAGATGCGGCAGAAGCCGGGGACAGTGATGATGAGG ‐ 3 ’ Rv : 5 ’ ‐ CCTCATCATCACTGTCCCCGGCTTCTGCCGCATCTCAGCTGCAGGC

U2OS and U2OS‐HIS‐SUMO2 cell lines [1] were grown in DMEM supplemented with 10% FCS and penicillin/streptomycin (Life Technologies). SLX4+/+ MEFs and SLX4‐/‐ MEFs [2] were also supplemented with non‐essential AAs. Every cell line was checked for mycoplasma contamination regularly. The result was always negative. mSLX4 was amplified by PCR from pBABE‐mSLX4 [2] and cloned into pDONR207 using a BP...

Degradation of Azo Dye Reactive Black 5 and Acid Orange 7 by Fenton-Like Mechanism

Degradation of crystal violet using copper modified iron oxide as heterogeneous photo-fenton reagent

The heterogeneous photo-Fenton degradation of crystal violet under visible light has been investigated usingcopper modified iron oxide. The photocatalyst has been prepared by coprecipitation method. The rate ofphotocatalyic degradation of dye was monitored spectrophotometrically. It has been observed thatphotocatalytic degradation follows pseudo first order kinetics. The effect of various param...

Synthesis of Some Nitrogen Functional Derivatives of 5-substituted-6-azauracil as Biologically Active Compounds

3-Arylhydrazono-2,4-dioxo-4-phenylbutanoates have been prepared by the coupling of benzoylpyruvate with aryldiazonium chlorides. Reactions of the 3-arylhydrazono-2,4- dioxo-4-phenylbutanoates with 1-aminoguanidine, semicarbazide, and thiosemicarbazide gave 5-substituted 2-imino-6-azauracil (3a), 6-azauracil (3b), and 2-thio-6-azauracil (3c), respectively. The analytical data of these compounds ...